DNA profiling


Each of us has a unique DNA profile or fingerprint. A technique called electrophoresis is used to obtain DNA profiles, relying on sections of our DNA that are known as non-coding DNA (DNA that does not code for a protein).

We have many sections of non-coding DNA in our genome. Within this non-coding DNA are areas called short tandem repeats (STRs). For example, you may have a stretch of DNA made up of the following base sequence:

ATCTTCTAACACATGACCGATCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGTTCCATGATAGCACAT

This sequence starts off looking random, but then has repeats of the sequence CATG towards the middle. It becomes random again near the end. The repetitive section of the sequence is what is referred to as an STR.

For a given STR, you will have inherited different numbers of the repeated sequence from each of your parents. For example, you may have inherited 11 repeats of the CATG sequence, as shown above, on a chromosome from your mother, and 3 repeats of this sequence within the STR on the matching chromosome from your father.

The different numbers of repeats within an STR results in DNA of different lengths. Because of this, electrophoresis can be used to show how many repeats you have.

Generating a DNA profile usually involves analysing an individual's DNA for ten different STRs on different chromosomes. Statistically, no two people (except identical twins) are likely to have the same numbers of repeats in all of these STRs.

Polymerase chain reaction (PCR) is used to produce many copies of the ten STRs before they are later analysed using electrophoresis. The different lengths of DNA will show up as bands at different spots on the electrophoresis gel (see picture above). The banding pattern produced is called a DNA profile or fingerprint, and can be analysed.

You can produce a DNA profile using a DNA sample from a crime scene - interactive